Review



ecliptic phluorin  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc ecliptic phluorin
    Ecliptic Phluorin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecliptic+phluorin/pCMV2-SEP-GluA1+(M1)+(Plasmid+%2364942)/pm40170502-58-21-25
    Average 93 stars, based on 8 article reviews
    ecliptic phluorin - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Generated:

    Article Title: CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes
    Article Snippet: .. We then generated a Gateway-compatible 3’-entry vector containing 4 tandem copies of super ecliptic pHluorin, using pcDNA3-SypHluorin4x (Addgene #37005) as a template for PCR and primers 5’-GGGGACAGCTTTCTTGTACAAAGTGG TCCCCCATGGATCTAGCCACC ATGG -3’ (attB2-(linker)4xpHluorin F, linker region underlined and pHluorin coding sequence in bold) and 5’-GGGGACAACTTTGTATAATAAAGTTGT TTA CGATAAGCTTGATCGAGCTCCA -3’ (attB3R-4xpHluorin R, terminal linker underlined and stop codon in bold) to amplify an attB-containing product, and recombining it with pDONRP2RP3 using BP clonase II. ..

    Article Title: CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes
    Article Snippet: .. We then generated a Gateway-compatible 3′-entry vector containing super ecliptic pHluorin, using pcDNA3-SypHluorin4x (Addgene #37005) as a template for PCR and primers 5′-GGGGACAGCTTTCTTGTACAAAGTGG TCCCCCATGGATCTAGCCACC ATGG −3 ′ (attB2-(linker)pHluorin F, linker region underlined and pHluorin coding sequence in bold) and 5′-GGGGACAACTTTGTATAATAAAGTTGT TTA CGATAAGCTTGATCGAGCTCCA −3′ (attB3R-pHluorin R, terminal linker underlined and stop codon in bold) to amplify an attB-containing product, and recombining it with pDONRP2RP3 using BP clonase II. ..

    Plasmid Preparation:

    Article Title: CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes
    Article Snippet: .. We then generated a Gateway-compatible 3’-entry vector containing 4 tandem copies of super ecliptic pHluorin, using pcDNA3-SypHluorin4x (Addgene #37005) as a template for PCR and primers 5’-GGGGACAGCTTTCTTGTACAAAGTGG TCCCCCATGGATCTAGCCACC ATGG -3’ (attB2-(linker)4xpHluorin F, linker region underlined and pHluorin coding sequence in bold) and 5’-GGGGACAACTTTGTATAATAAAGTTGT TTA CGATAAGCTTGATCGAGCTCCA -3’ (attB3R-4xpHluorin R, terminal linker underlined and stop codon in bold) to amplify an attB-containing product, and recombining it with pDONRP2RP3 using BP clonase II. ..

    Article Title: The synaptic availability of GluA1 is reduced in hippocampal neurons of a murine model of dynamin-2 linked autosomal dominant centronuclear myopathy
    Article Snippet: .. At 5-day-in-vitro (DIV), neurons were transfected using lipofectamine 2000 (Invitrogen; Thermo Scientific, IL, USA) with a construct expressing GluA1-fused to super ecliptic-pHluorin (SEP, plasmid #64942 Addgene). ..

    Article Title: CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes
    Article Snippet: .. We then generated a Gateway-compatible 3′-entry vector containing super ecliptic pHluorin, using pcDNA3-SypHluorin4x (Addgene #37005) as a template for PCR and primers 5′-GGGGACAGCTTTCTTGTACAAAGTGG TCCCCCATGGATCTAGCCACC ATGG −3 ′ (attB2-(linker)pHluorin F, linker region underlined and pHluorin coding sequence in bold) and 5′-GGGGACAACTTTGTATAATAAAGTTGT TTA CGATAAGCTTGATCGAGCTCCA −3′ (attB3R-pHluorin R, terminal linker underlined and stop codon in bold) to amplify an attB-containing product, and recombining it with pDONRP2RP3 using BP clonase II. ..

    Article Title: The synaptic availability of GluA1 is reduced in hippocampal neurons of a murine model of dynamin-2 linked autosomal dominant centronuclear myopathy.
    Article Snippet: .. At 5-day-in-vitro (DIV), neurons were transfected using lipofectamine 2000 (Invitrogen; Thermo Scientific, IL, USA) with a construct expressing GluA1-fused to super ecliptic-pHluorin (SEP, plasmid #64942 Addgene). ..

    Polymerase Chain Reaction:

    Article Title: CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes
    Article Snippet: .. We then generated a Gateway-compatible 3’-entry vector containing 4 tandem copies of super ecliptic pHluorin, using pcDNA3-SypHluorin4x (Addgene #37005) as a template for PCR and primers 5’-GGGGACAGCTTTCTTGTACAAAGTGG TCCCCCATGGATCTAGCCACC ATGG -3’ (attB2-(linker)4xpHluorin F, linker region underlined and pHluorin coding sequence in bold) and 5’-GGGGACAACTTTGTATAATAAAGTTGT TTA CGATAAGCTTGATCGAGCTCCA -3’ (attB3R-4xpHluorin R, terminal linker underlined and stop codon in bold) to amplify an attB-containing product, and recombining it with pDONRP2RP3 using BP clonase II. ..

    Article Title: CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes
    Article Snippet: .. We then generated a Gateway-compatible 3′-entry vector containing super ecliptic pHluorin, using pcDNA3-SypHluorin4x (Addgene #37005) as a template for PCR and primers 5′-GGGGACAGCTTTCTTGTACAAAGTGG TCCCCCATGGATCTAGCCACC ATGG −3 ′ (attB2-(linker)pHluorin F, linker region underlined and pHluorin coding sequence in bold) and 5′-GGGGACAACTTTGTATAATAAAGTTGT TTA CGATAAGCTTGATCGAGCTCCA −3′ (attB3R-pHluorin R, terminal linker underlined and stop codon in bold) to amplify an attB-containing product, and recombining it with pDONRP2RP3 using BP clonase II. ..

    Sequencing:

    Article Title: CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes
    Article Snippet: .. We then generated a Gateway-compatible 3’-entry vector containing 4 tandem copies of super ecliptic pHluorin, using pcDNA3-SypHluorin4x (Addgene #37005) as a template for PCR and primers 5’-GGGGACAGCTTTCTTGTACAAAGTGG TCCCCCATGGATCTAGCCACC ATGG -3’ (attB2-(linker)4xpHluorin F, linker region underlined and pHluorin coding sequence in bold) and 5’-GGGGACAACTTTGTATAATAAAGTTGT TTA CGATAAGCTTGATCGAGCTCCA -3’ (attB3R-4xpHluorin R, terminal linker underlined and stop codon in bold) to amplify an attB-containing product, and recombining it with pDONRP2RP3 using BP clonase II. ..

    Article Title: CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes
    Article Snippet: .. We then generated a Gateway-compatible 3′-entry vector containing super ecliptic pHluorin, using pcDNA3-SypHluorin4x (Addgene #37005) as a template for PCR and primers 5′-GGGGACAGCTTTCTTGTACAAAGTGG TCCCCCATGGATCTAGCCACC ATGG −3 ′ (attB2-(linker)pHluorin F, linker region underlined and pHluorin coding sequence in bold) and 5′-GGGGACAACTTTGTATAATAAAGTTGT TTA CGATAAGCTTGATCGAGCTCCA −3′ (attB3R-pHluorin R, terminal linker underlined and stop codon in bold) to amplify an attB-containing product, and recombining it with pDONRP2RP3 using BP clonase II. ..

    Transfection:

    Article Title: The synaptic availability of GluA1 is reduced in hippocampal neurons of a murine model of dynamin-2 linked autosomal dominant centronuclear myopathy
    Article Snippet: .. At 5-day-in-vitro (DIV), neurons were transfected using lipofectamine 2000 (Invitrogen; Thermo Scientific, IL, USA) with a construct expressing GluA1-fused to super ecliptic-pHluorin (SEP, plasmid #64942 Addgene). ..

    Article Title: The synaptic availability of GluA1 is reduced in hippocampal neurons of a murine model of dynamin-2 linked autosomal dominant centronuclear myopathy.
    Article Snippet: .. At 5-day-in-vitro (DIV), neurons were transfected using lipofectamine 2000 (Invitrogen; Thermo Scientific, IL, USA) with a construct expressing GluA1-fused to super ecliptic-pHluorin (SEP, plasmid #64942 Addgene). ..

    Construct:

    Article Title: The synaptic availability of GluA1 is reduced in hippocampal neurons of a murine model of dynamin-2 linked autosomal dominant centronuclear myopathy
    Article Snippet: .. At 5-day-in-vitro (DIV), neurons were transfected using lipofectamine 2000 (Invitrogen; Thermo Scientific, IL, USA) with a construct expressing GluA1-fused to super ecliptic-pHluorin (SEP, plasmid #64942 Addgene). ..

    Article Title: The synaptic availability of GluA1 is reduced in hippocampal neurons of a murine model of dynamin-2 linked autosomal dominant centronuclear myopathy.
    Article Snippet: .. At 5-day-in-vitro (DIV), neurons were transfected using lipofectamine 2000 (Invitrogen; Thermo Scientific, IL, USA) with a construct expressing GluA1-fused to super ecliptic-pHluorin (SEP, plasmid #64942 Addgene). ..

    Expressing:

    Article Title: The synaptic availability of GluA1 is reduced in hippocampal neurons of a murine model of dynamin-2 linked autosomal dominant centronuclear myopathy
    Article Snippet: .. At 5-day-in-vitro (DIV), neurons were transfected using lipofectamine 2000 (Invitrogen; Thermo Scientific, IL, USA) with a construct expressing GluA1-fused to super ecliptic-pHluorin (SEP, plasmid #64942 Addgene). ..

    Article Title: The synaptic availability of GluA1 is reduced in hippocampal neurons of a murine model of dynamin-2 linked autosomal dominant centronuclear myopathy.
    Article Snippet: .. At 5-day-in-vitro (DIV), neurons were transfected using lipofectamine 2000 (Invitrogen; Thermo Scientific, IL, USA) with a construct expressing GluA1-fused to super ecliptic-pHluorin (SEP, plasmid #64942 Addgene). ..



    Similar Products

    86
    Twist Bioscience super ecliptic phluorin
    Super Ecliptic Phluorin, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecliptic+phluorin/ecliptic+phluorin+super/bio_rxiv__64898__2026__04__24__720392-87-11-19
    Average 86 stars, based on 1 article reviews
    super ecliptic phluorin - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Thermo Fisher super-ecliptic phluorin
    Data were collected from BW25113 E. coli cells expressing <t>pHluorin</t> and bathed in M9 minimal medium, unless otherwise specified. a Surface plot of pHluorin-reported BacFlashes as peaks overlaying a confocal fluorescence image of rod-shaped cells. Three spontaneous events registered in 100-s periods are shown. b Traces of BacFlashes in cells with BacFlashes occurring. Each row represents BacFlash activities from a single cell in a 100-s period. c Membrane depolarization and ROS burst in a BacFlash reported by TMRM and DCF, respectively, with pHluorin or pHtomato reporting the pHi transient. d BacFlash frequency in different E. coli strains. The frequency was indicated by quantifying the flash number in 1000 µm2 of cell area in 100 s. Data are means ± SEM. n = 17–27 image stacks per group. e Inhibition of BacFlash activity by ETC blocker and an uncoupler. KCN (5 mM) for complex IV and the uncoupler FCCP (10 µM) were used. Data are means ± SEM. n = 23–38 image stacks per group. ***P < 0.001 vs control group.
    Super Ecliptic Phluorin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecliptic+phluorin/super+ecliptic+phluorin/pmc08169942-326-10-26
    Average 90 stars, based on 1 article reviews
    super-ecliptic phluorin - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc ecliptic phluorin
    Data were collected from BW25113 E. coli cells expressing <t>pHluorin</t> and bathed in M9 minimal medium, unless otherwise specified. a Surface plot of pHluorin-reported BacFlashes as peaks overlaying a confocal fluorescence image of rod-shaped cells. Three spontaneous events registered in 100-s periods are shown. b Traces of BacFlashes in cells with BacFlashes occurring. Each row represents BacFlash activities from a single cell in a 100-s period. c Membrane depolarization and ROS burst in a BacFlash reported by TMRM and DCF, respectively, with pHluorin or pHtomato reporting the pHi transient. d BacFlash frequency in different E. coli strains. The frequency was indicated by quantifying the flash number in 1000 µm2 of cell area in 100 s. Data are means ± SEM. n = 17–27 image stacks per group. e Inhibition of BacFlash activity by ETC blocker and an uncoupler. KCN (5 mM) for complex IV and the uncoupler FCCP (10 µM) were used. Data are means ± SEM. n = 23–38 image stacks per group. ***P < 0.001 vs control group.
    Ecliptic Phluorin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecliptic+phluorin/pCMV2-SEP-GluA1+(M1)+(Plasmid+%2364942)/pm40170502-58-21-25
    Average 93 stars, based on 1 article reviews
    ecliptic phluorin - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc ecliptic phluorin a242d
    Data were collected from BW25113 E. coli cells expressing <t>pHluorin</t> and bathed in M9 minimal medium, unless otherwise specified. a Surface plot of pHluorin-reported BacFlashes as peaks overlaying a confocal fluorescence image of rod-shaped cells. Three spontaneous events registered in 100-s periods are shown. b Traces of BacFlashes in cells with BacFlashes occurring. Each row represents BacFlash activities from a single cell in a 100-s period. c Membrane depolarization and ROS burst in a BacFlash reported by TMRM and DCF, respectively, with pHluorin or pHtomato reporting the pHi transient. d BacFlash frequency in different E. coli strains. The frequency was indicated by quantifying the flash number in 1000 µm2 of cell area in 100 s. Data are means ± SEM. n = 17–27 image stacks per group. e Inhibition of BacFlash activity by ETC blocker and an uncoupler. KCN (5 mM) for complex IV and the uncoupler FCCP (10 µM) were used. Data are means ± SEM. n = 23–38 image stacks per group. ***P < 0.001 vs control group.
    Ecliptic Phluorin A242d, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecliptic+phluorin/Axin+DeltaRGS%2FpCS2MT+(Plasmid+%2316304)/pm38829505-42-16-19
    Average 93 stars, based on 1 article reviews
    ecliptic phluorin a242d - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Makino Inc super ecliptic phluorin (sep)
    Synaptic proteins exploited for developing sensors (numbers in parentheses refer to Table , first column). Synaptobrevin (VAMP) is used by <t>Synapto‐pHluorin</t> (1), VAMP4‐pHluorin (5), syb2‐mOrange (7), VAMP2‐pHmScarlet (9), eGFP‐SynaptoZip (16), mCherry‐SynaptoZip (17) and (together with CD‐4) by Syb‐GRASP (18). Synaptophysin (p38) is used by SypHy (2), SypHTomato (8), pHoenix (13), SyGCaMP2 (19), SyGCaMP3 (20), SyGCaMP5G (21), SyGCaMP6 (22), SypHy‐RGECO (23), preSynTagMA (27) and Syn‐ATP (35). Synaptotagmin (syt, p65) is used by pHluorin‐syt‐IV (3), pHluorin‐syt‐1‐17 (4) and anti‐p65 (15). VGLUT is used by VGLUT1‐pHluorin (6) and VGLUT1‐mOr2 (14). VGAT is used by VGAT‐pHluorin (11). Synaptic vesicle protein 2A (SV2A) is used by SV2A‐pHluorin (12). β‐Actin is used by GCaMP2‐actin (24). PSD‐95 is used by PSD95‐GCaMP2 (25) and PSD‐95‐GCaMP5K (26), whereas its mutation PSDΔ1.2 is used by AS‐PaRac1 (37). VMAT2 is used by FN200 (28). GluR1 and GluR2 are used by <t>SEP‐GluR1</t> and SEP‐GluR2 (36). As for G‐protein coupled receptors, mGLUR is used by pHluorin‐tagged mGluR7 (10); DRD1, DRD2 and DRD4 are used by dLight (29); DRD2 is used by GRAB DA (30) and rGRAB DA (31); MR is used by GACh (32); a2AR is used by GRAB NE (33); and 5‐HT2C is used by GRAB 5‐HT (34).
    Super Ecliptic Phluorin (Sep), supplied by Makino Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecliptic+phluorin/sep+glua1/pmc10100385-35-8-34
    Average 90 stars, based on 1 article reviews
    super ecliptic phluorin (sep) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    91
    Addgene inc ecliptic phluorin mruby2 fusion protein
    Synaptic proteins exploited for developing sensors (numbers in parentheses refer to Table , first column). Synaptobrevin (VAMP) is used by <t>Synapto‐pHluorin</t> (1), VAMP4‐pHluorin (5), syb2‐mOrange (7), VAMP2‐pHmScarlet (9), eGFP‐SynaptoZip (16), mCherry‐SynaptoZip (17) and (together with CD‐4) by Syb‐GRASP (18). Synaptophysin (p38) is used by SypHy (2), SypHTomato (8), pHoenix (13), SyGCaMP2 (19), SyGCaMP3 (20), SyGCaMP5G (21), SyGCaMP6 (22), SypHy‐RGECO (23), preSynTagMA (27) and Syn‐ATP (35). Synaptotagmin (syt, p65) is used by pHluorin‐syt‐IV (3), pHluorin‐syt‐1‐17 (4) and anti‐p65 (15). VGLUT is used by VGLUT1‐pHluorin (6) and VGLUT1‐mOr2 (14). VGAT is used by VGAT‐pHluorin (11). Synaptic vesicle protein 2A (SV2A) is used by SV2A‐pHluorin (12). β‐Actin is used by GCaMP2‐actin (24). PSD‐95 is used by PSD95‐GCaMP2 (25) and PSD‐95‐GCaMP5K (26), whereas its mutation PSDΔ1.2 is used by AS‐PaRac1 (37). VMAT2 is used by FN200 (28). GluR1 and GluR2 are used by <t>SEP‐GluR1</t> and SEP‐GluR2 (36). As for G‐protein coupled receptors, mGLUR is used by pHluorin‐tagged mGluR7 (10); DRD1, DRD2 and DRD4 are used by dLight (29); DRD2 is used by GRAB DA (30) and rGRAB DA (31); MR is used by GACh (32); a2AR is used by GRAB NE (33); and 5‐HT2C is used by GRAB 5‐HT (34).
    Ecliptic Phluorin Mruby2 Fusion Protein, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecliptic+phluorin/pKL06+(Plasmid+%23104430)/pmc07329899-295-21-28
    Average 91 stars, based on 1 article reviews
    ecliptic phluorin mruby2 fusion protein - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    Image Search Results


    Data were collected from BW25113 E. coli cells expressing pHluorin and bathed in M9 minimal medium, unless otherwise specified. a Surface plot of pHluorin-reported BacFlashes as peaks overlaying a confocal fluorescence image of rod-shaped cells. Three spontaneous events registered in 100-s periods are shown. b Traces of BacFlashes in cells with BacFlashes occurring. Each row represents BacFlash activities from a single cell in a 100-s period. c Membrane depolarization and ROS burst in a BacFlash reported by TMRM and DCF, respectively, with pHluorin or pHtomato reporting the pHi transient. d BacFlash frequency in different E. coli strains. The frequency was indicated by quantifying the flash number in 1000 µm2 of cell area in 100 s. Data are means ± SEM. n = 17–27 image stacks per group. e Inhibition of BacFlash activity by ETC blocker and an uncoupler. KCN (5 mM) for complex IV and the uncoupler FCCP (10 µM) were used. Data are means ± SEM. n = 23–38 image stacks per group. ***P < 0.001 vs control group.

    Journal: Cell Research

    Article Title: BacFlash signals acid-resistance gene expression in bacteria

    doi: 10.1038/s41422-020-00431-3

    Figure Lengend Snippet: Data were collected from BW25113 E. coli cells expressing pHluorin and bathed in M9 minimal medium, unless otherwise specified. a Surface plot of pHluorin-reported BacFlashes as peaks overlaying a confocal fluorescence image of rod-shaped cells. Three spontaneous events registered in 100-s periods are shown. b Traces of BacFlashes in cells with BacFlashes occurring. Each row represents BacFlash activities from a single cell in a 100-s period. c Membrane depolarization and ROS burst in a BacFlash reported by TMRM and DCF, respectively, with pHluorin or pHtomato reporting the pHi transient. d BacFlash frequency in different E. coli strains. The frequency was indicated by quantifying the flash number in 1000 µm2 of cell area in 100 s. Data are means ± SEM. n = 17–27 image stacks per group. e Inhibition of BacFlash activity by ETC blocker and an uncoupler. KCN (5 mM) for complex IV and the uncoupler FCCP (10 µM) were used. Data are means ± SEM. n = 23–38 image stacks per group. ***P < 0.001 vs control group.

    Article Snippet: Construction and expression of pHluorin and pHtomato The genes for super-ecliptic pHluorin (GenBank: AF058694.2 ) 14 and pHtomato (GenBank: JQ966306.1 ) 15 were cloned into pTricHisA (Thermo Fisher Scientific, Massachusetts, USA) using the Bam HI and Hind III restriction sites.

    Techniques: Expressing, Fluorescence, Membrane, Inhibition, Activity Assay, Control

    Synaptic proteins exploited for developing sensors (numbers in parentheses refer to Table , first column). Synaptobrevin (VAMP) is used by Synapto‐pHluorin (1), VAMP4‐pHluorin (5), syb2‐mOrange (7), VAMP2‐pHmScarlet (9), eGFP‐SynaptoZip (16), mCherry‐SynaptoZip (17) and (together with CD‐4) by Syb‐GRASP (18). Synaptophysin (p38) is used by SypHy (2), SypHTomato (8), pHoenix (13), SyGCaMP2 (19), SyGCaMP3 (20), SyGCaMP5G (21), SyGCaMP6 (22), SypHy‐RGECO (23), preSynTagMA (27) and Syn‐ATP (35). Synaptotagmin (syt, p65) is used by pHluorin‐syt‐IV (3), pHluorin‐syt‐1‐17 (4) and anti‐p65 (15). VGLUT is used by VGLUT1‐pHluorin (6) and VGLUT1‐mOr2 (14). VGAT is used by VGAT‐pHluorin (11). Synaptic vesicle protein 2A (SV2A) is used by SV2A‐pHluorin (12). β‐Actin is used by GCaMP2‐actin (24). PSD‐95 is used by PSD95‐GCaMP2 (25) and PSD‐95‐GCaMP5K (26), whereas its mutation PSDΔ1.2 is used by AS‐PaRac1 (37). VMAT2 is used by FN200 (28). GluR1 and GluR2 are used by SEP‐GluR1 and SEP‐GluR2 (36). As for G‐protein coupled receptors, mGLUR is used by pHluorin‐tagged mGluR7 (10); DRD1, DRD2 and DRD4 are used by dLight (29); DRD2 is used by GRAB DA (30) and rGRAB DA (31); MR is used by GACh (32); a2AR is used by GRAB NE (33); and 5‐HT2C is used by GRAB 5‐HT (34).

    Journal: The European Journal of Neuroscience

    Article Title: Exploiting the molecular diversity of the synapse to investigate neuronal communication: A guide through the current toolkit

    doi: 10.1111/ejn.15848

    Figure Lengend Snippet: Synaptic proteins exploited for developing sensors (numbers in parentheses refer to Table , first column). Synaptobrevin (VAMP) is used by Synapto‐pHluorin (1), VAMP4‐pHluorin (5), syb2‐mOrange (7), VAMP2‐pHmScarlet (9), eGFP‐SynaptoZip (16), mCherry‐SynaptoZip (17) and (together with CD‐4) by Syb‐GRASP (18). Synaptophysin (p38) is used by SypHy (2), SypHTomato (8), pHoenix (13), SyGCaMP2 (19), SyGCaMP3 (20), SyGCaMP5G (21), SyGCaMP6 (22), SypHy‐RGECO (23), preSynTagMA (27) and Syn‐ATP (35). Synaptotagmin (syt, p65) is used by pHluorin‐syt‐IV (3), pHluorin‐syt‐1‐17 (4) and anti‐p65 (15). VGLUT is used by VGLUT1‐pHluorin (6) and VGLUT1‐mOr2 (14). VGAT is used by VGAT‐pHluorin (11). Synaptic vesicle protein 2A (SV2A) is used by SV2A‐pHluorin (12). β‐Actin is used by GCaMP2‐actin (24). PSD‐95 is used by PSD95‐GCaMP2 (25) and PSD‐95‐GCaMP5K (26), whereas its mutation PSDΔ1.2 is used by AS‐PaRac1 (37). VMAT2 is used by FN200 (28). GluR1 and GluR2 are used by SEP‐GluR1 and SEP‐GluR2 (36). As for G‐protein coupled receptors, mGLUR is used by pHluorin‐tagged mGluR7 (10); DRD1, DRD2 and DRD4 are used by dLight (29); DRD2 is used by GRAB DA (30) and rGRAB DA (31); MR is used by GACh (32); a2AR is used by GRAB NE (33); and 5‐HT2C is used by GRAB 5‐HT (34).

    Article Snippet: 36 , SEP‐GluR1 SEP‐GluR2 , GluR1 GluR2 , Super ecliptic pHluorin (SEP) , AMPAR tag , Yes , AMPA recruitment , Yes , Yes , Conditional expression Limited time window Altered electrical responses , Makino & Malinow ( ) , .

    Techniques: Mutagenesis

    Methods for measuring synaptic communication based on synaptic proteins

    Journal: The European Journal of Neuroscience

    Article Title: Exploiting the molecular diversity of the synapse to investigate neuronal communication: A guide through the current toolkit

    doi: 10.1111/ejn.15848

    Figure Lengend Snippet: Methods for measuring synaptic communication based on synaptic proteins

    Article Snippet: 36 , SEP‐GluR1 SEP‐GluR2 , GluR1 GluR2 , Super ecliptic pHluorin (SEP) , AMPAR tag , Yes , AMPA recruitment , Yes , Yes , Conditional expression Limited time window Altered electrical responses , Makino & Malinow ( ) , .

    Techniques: In Vitro, In Vivo, Imaging, Fluorescence, Activation Assay, Transmission Assay, Activity Assay, Luciferase, Expressing